Prev. |  KEGG KO K15258 > 

RIKEN DNA Bank Human Resource - PARP6

Gene ID NCBI Gene 56965 |  KEGG hsa:56965
Gene Symbol PARP6
Protein Name poly(ADP-ribose) polymerase family member 6
Synonyms ARTD17|PARP-6-B1|PARP-6-C|pART17
Ortholog resource in our bank

  PARP6

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX020928 IRAK052F08 pCMV-SPORT6 BC026955 NM_020213 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR247343 ARiS118F23 pGCAP10 NM_020214.2  
GCCCGGGCCGCTCGTCCCGTCGGCTGCGGCCGCGCGCGGCCCGGGGTCGCCGTGAGTACT
HKR360449 RBd01C01 pGCAP10 NM_020214.2  
TTGCCCTACCTTGTCTCCCTTTGTGGTCTCCTAAATGCCCATCTCGTTGGCCTTGGTTCG
HKR398899 RBd97E03 pGCAP10 NM_020214.2  
GGGGGGAGCGCGCCCGTGACGGAACGACGAGGCGTGGGGTGCGCGACCTCGCCCGCCAGG
HKR432711 RBdS081M23 pGCAP10 NM_020214.2  

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.09

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl