Prev. | NRCD Clone R | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP06802

HP ID(1) HP06802
Gene ID(2) 8732
Gene Symbol finder RNGTT
Protein Name RNA guanylyltransferase and 5'-phosphatase
RefSeq NM_003800.3
Length of RefSeq (bp) 4463
Chromosome 6q16
Reference DDBJ accession
UniGene Hs.567378

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
RBd01A01 pGCAP10 GGCATTGTGGGTTCTCCTGGAGCTGTGGAGTTGATCCTGAATGAAAGTGGCGCGCCGCCC
RBdS007C05 pGCAP10 TAAGGGAGCTGTGGAGTTGATCCTGAATGAAAGTGGCGCGCCGCCCCTGACGTTACCCGG

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl