Prev. | NRCD Clone R | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP06797

HP ID(1) HP06797
Gene ID(2) 64777
Gene Symbol finder RMND5B
Protein Name required for meiotic nuclear division 5 homolog B (S. cerevisiae)
RefSeq NM_022762.3
Length of RefSeq (bp) 1825
Chromosome 5q35.3
Reference DDBJ accession
UniGene Hs.716508

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARf07F11 pKA1U5 GGACAGTGGCGCCGGAAGCCGGGGCCGGGGCTGCGGTGCGAGTTGTCGGCCCTGGGCCGG

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl