Prev. | NRCD Clone C | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP06795

HP ID(1) HP06795
Gene ID(2) 9315
Gene Symbol finder C5orf13
Protein Name chromosome 5 open reading frame 13
RefSeq NM_004772.1
Length of RefSeq (bp) 2036
Chromosome 5q22.1
Reference DDBJ accession
UniGene Hs.36053

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARf07D06 pKA1U5 GGTGTTTCAGGTGTAGAGAGGAGAGAGAGTGAACANGGCAGCGGGGCTTTTGTCTGTTGG
ARi10F07 pGCAP10 TGACATTTGTGTTTCAGGTGTAGAGAGGAGAGAGAGTGAACAGGGAGCGGGGCTTTTGTC
RBd39E06 pGCAP10 ACATTTGTGTTTCAGGTGTAGAGAGGAGAGAGAGTGAACAGGGAGCGGGGCTTTTGTCTG
RBd42E06 pGCAP10 GACATTTGTGTTTCAGGTGTAGAGAGGAGAGAGAGTGAACAGGGAGCGGGGCTTTTGTCT
RBd61H06 pGCAP10 GACACATTTGTGTTTCAGGTGTAGAGAGGAGAGAGAGTGAACAGGGAGCGGGGCTTTTGT
RBd94D06 pGCAP10 GACATTTGTGTTTCAGGTGTAGAGAGGAGAGAGAGTGAACAGGGAGCGGGGCTTTTGTCT
RBdS154C22 pGCAP10 GGTGCAGTGGGGACGGCGCGGCGAGCGGGGCGCCCGGGGCGCGGGTGCGGGGTGTCGGGG

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl