Prev. | Human A to Z list > N > 

RIKEN DNA Bank Human Resource - NREP

Gene ID (NCBI) 9315
Gene Symbol NREP
Protein Name neuronal regeneration related protein
Synonyms C5orf13|D4S114|P311|PRO1873|PTZ17|SEZ17
Databases KEGG link 01 |  NCBI Gene link 01


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector(1) Sequence CDS status(3)
Submitted (DDBJ)(2) Refered (NCBI mRNA)
HGX069842 IRAK174K02 pCMV-SPORT6 BC072443 NM_004772 Full
HGY095839 IRAL039J23 pOTB7 BC019068 NM_004772 Full
HGY103380 IRAL058H12 pOTB7 BC072013 NM_004772 Full

(1) Extra 1,250 YEN (license fee) is required for Gateway® Expression Clone (pCMV SPORT6 and related vectors).
(2) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(3) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_170405.csv
GNP_full_IRAL_170405.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR082878 ARf07D06 pKA1U5 NM_004772.1  
GGTGTTTCAGGTGTAGAGAGGAGAGAGAGTGAACANGGCAGCGGGGCTTTTGTCTGTTGG
HKR164127 ARi10F07 pGCAP10 NM_004772.1  
TGACATTTGTGTTTCAGGTGTAGAGAGGAGAGAGAGTGAACAGGGAGCGGGGCTTTTGTC
HKR375702 RBd39E06 pGCAP10 NM_004772.1  
ACATTTGTGTTTCAGGTGTAGAGAGGAGAGAGAGTGAACAGGGAGCGGGGCTTTTGTCTG
HKR376902 RBd42E06 pGCAP10 NM_004772.1  
GACATTTGTGTTTCAGGTGTAGAGAGGAGAGAGAGTGAACAGGGAGCGGGGCTTTTGTCT
HKR384574 RBd61H06 pGCAP10 NM_004772.1  
GACACATTTGTGTTTCAGGTGTAGAGAGGAGAGAGAGTGAACAGGGAGCGGGGCTTTTGT
HKR397678 RBd94D06 pGCAP10 NM_004772.1  
GACATTTGTGTTTCAGGTGTAGAGAGGAGAGAGAGTGAACAGGGAGCGGGGCTTTTGTCT
HKR461670 RBdS154C22 pGCAP10 NM_004772.1  
GGTGCAGTGGGGACGGCGCGGCGAGCGGGGCGCCCGGGGCGCGGGTGCGGGGTGTCGGGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2017.08.25

Homo_sapiens_gene_info140110 - RDB_hum_GIxxxxxxxxx_html_170416.pl