Prev. | NRCD Clone C | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP06717

HP ID(1) HP06717
Gene ID(2) 387882
Gene Symbol finder C12orf75
Protein Name chromosome 12 open reading frame 75
RefSeq NM_001145199.1
Length of RefSeq (bp) 1383
Chromosome 12q23.3
Reference DDBJ accession
UniGene Hs.368938

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe95B10 pKA1U5 GGCCCGGCAGCCCGCAGCCCGCTGCGCCCCGGGCCGCGATCTCCCGGCGGTGGGAGGGGG
ARiS049I02 pGCAP10 GTTTCCGCCCGGCAGCCCGCAGCCCGCTGCGCCCCGGGCCGCGTCTCCCGGCGGTGGGAG
ARiS088G17 pGCAP10 GGCAGCCCGCAGCCCGCTGCGCCCCGGGCCGCGTCTCCCGGCGGTGGGAGGGGGCGGCCC

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl