Prev. | 

RIKEN DNA Bank Human Resource - C12orf75

Gene ID NCBI Gene 387882 |  KEGG hsa:387882
Gene Symbol C12orf75
Protein Name chromosome 12 open reading frame 75
Synonyms AGD3|OCC-1|OCC1
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY036213 IRAK090I21 pBluescript BC045812 NM_207376 Full
HGX053772 IRAK134H04 pCMV-SPORT6 BC061920 NM_207376 Full
HGY067296 IRAK168D24 pBluescriptR BC067897 NM_207376 Full
HGY092477 IRAL031D05 pDNR-LIB BC013920 NM_207376 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE082840 M01C007B16 pDONR221 FLJ01-D08 AK056999 NM_207376  
HGE082888 M01C007D16 pDONR221 FLJ01-D08 AK056999 NM_207376  
HGE082936 M01C007F16 pDONR221 FLJ01-D08 AK056999 NM_207376  
HGE082984 M01C007H16 pDONR221 FLJ01-D08 AK056999 NM_207376  
HGE083032 M01C007J16 pDONR221 FLJ01-D08 AK056999 NM_207376  
HGE083080 M01C007L16 pDONR221 FLJ01-D08 AK056999 NM_207376  
HGE083128 M01C007N16 pDONR221 FLJ01-D08 AK056999 NM_207376  
HGE083176 M01C007P16 pDONR221 FLJ01-D08 AK056999 NM_207376  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR078034 ARe95B10 pKA1U5 NM_001145199.1  
GGCCCGGCAGCCCGCAGCCCGCTGCGCCCCGGGCCGCGATCTCCCGGCGGTGGGAGGGGG
HKR219794 ARiS049I02 pGCAP10 NM_001145199.1  
GTTTCCGCCCGGCAGCCCGCAGCCCGCTGCGCCCCGGGCCGCGTCTCCCGGCGGTGGGAG
HKR235361 ARiS088G17 pGCAP10 NM_001145199.1  
GGCAGCCCGCAGCCCGCTGCGCCCCGGGCCGCGTCTCCCGGCGGTGGGAGGGGGCGGCCC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.09

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl