Prev. | NRCD Clone C | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP06710

HP ID(1) HP06710
Gene ID(2) 254427
Gene Symbol finder C10orf47
Protein Name chromosome 10 open reading frame 47
RefSeq NM_153256.3
Length of RefSeq (bp) 3360
Chromosome 10p14
Reference DDBJ accession
UniGene Hs.435775

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe94B03 pKA1U5 GCCCGGAACAGTCTGCGCCAGACGGGCGGCGGCGTGAGGGCTCCGGGTCGCTGGCGGCGT

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl