Prev. | 

RIKEN DNA Bank Human Resource - PROSER2

Gene ID NCBI Gene 254427 |  KEGG hsa:254427
Gene Symbol PROSER2
Protein Name proline and serine rich 2
Synonyms C10orf47
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX020164 IRAK050G20 pCMV-SPORT6 BC029134 NM_153256 Partial/var
HGX035606 IRAK089A06 pCMV-SPORT6 BC040040 NM_153256 Partial/var
HGX037442 IRAK093K02 pCMV-SPORT6 BC048800 NM_153256
HGY095710 IRAL039E14 pOTB7 BC017269 NM_153256 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR077627 ARe94B03 pKA1U5 NM_153256.3  
GCCCGGAACAGTCTGCGCCAGACGGGCGGCGGCGTGAGGGCTCCGGGTCGCTGGCGGCGT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.09

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl