Prev. | NRCD Clone V | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP06704

HP ID(1) HP06704
Gene ID(2) 154807
Gene Symbol finder VKORC1L1
Protein Name vitamin K epoxide reductase complex, subunit 1-like 1
RefSeq NM_173517.3
Length of RefSeq (bp) 1148
Chromosome 7q11.21
Reference DDBJ accession
UniGene Hs.427232

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe14B03 pKA1U5 GACTCCTTTTGGGGCGGTTGGGCCGCGCGCCTGCTGNGGGCGGGGCCCGGAGCAGGCCAC
ARe93B05 pKA1U5 GGTGGCGGCGGCGGCGGAGGCGGCGGTGGCGGCGGTGGCGGCTGGGTCGGGCCCCGACGG
ARi39D08 pGCAP10 GGGCGGAGGCGGCGGTGGCGGCGGTGGCGGCTGGGTCGGGCCCCGACGGGCGGCGGCGGC
RBd71G08 pGCAP10 GGGCGGCGGCGGCGGAGGCGGCGGTGGCGGCGGTGGCGGCTGGGTCGGGCCCCGACGGGC

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl