Prev. | NRCD Clone N | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP06699

HP ID(1) HP06699
Gene ID(2) 51335
Gene Symbol finder NGRN
Protein Name neugrin, neurite outgrowth associated
RefSeq NM_016645.2
Length of RefSeq (bp) 1782
Chromosome 15q26.1
Reference DDBJ accession
UniGene Hs.716378

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe92G01 pKA1U5 GGCCGACTGCTGAAGGCTGGTTTGCGTCGACATGGCGGTTACCCTGAGTCTCTTGCTGGG
ARi38H11 pGCAP10 GCCGGCTACTTCCGCTGCTGTTTCGTAGCCGACTGCTGAAGGCTGGTTTGCGTCGACATG
ARiS109G03 pGCAP10 GGCTGAAGGCTGGTTTGCGTCGACATGGCGGTTACCCTGAGTCTCTTGCTGGGCGGGCGC
ARiS194K15 pGCAP10 GGAAGGCTGGTTTGCGTCGACATGGCGGTTACCCTGAGTCTCTTGCTGGGCGGGCGCGTT
RBd27E12 pGCAP10 GGTTTCGTAGCCGACTGCTGAAGGCTGGTTTGCGTCGACATGGCGGTTACCCTGAGTCTC
RBd32F09 pGCAP10 GGAAGGCTGGTTTGCGTCGACATGGCGGTTACCCTGAGTCTCTTGCTGGGCGGGCGCGTT
RBdS083O19 pGCAP10 GGAAGGCTGGTTTGCGTCGACATGGCGGTTACCCTGAGTCTCTTGCTGGGCGGGCGCGTT

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl