Prev. | Human A to Z list > N > 

RIKEN DNA Bank Human Resource - NGRN

Gene ID (NCBI) 51335
Gene Symbol NGRN
Protein Name neugrin, neurite outgrowth associated
Synonyms DSC92
Databases KEGG link 01 |  NCBI Gene link 01


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector(1) Sequence CDS status(3)
Submitted (DDBJ)(2) Refered (NCBI mRNA)
HGY081038 IRAL002J22 pOTB7 BC001682 NM_016645 Full
HGY081647 IRAL004B23 pOTB7 BC017192 NM_016645 Full
HGY088804 IRAL022A04 pOTB7 BC007222 NM_016645 Full
HGY090619 IRAL026J03 pOTB7 BC009389 NM_016645 Full

(1) Extra 1,250 YEN (license fee) is required for Gateway® Expression Clone (pCMV SPORT6 and related vectors).
(2) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(3) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_170405.csv
GNP_full_IRAL_170405.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE024475 W01A061D03 pENTR-TOPO IRAL002J22 BC001682 NM_016645  
HGE024477 W01A061D05 pENTR-TOPO IRAL002J22 BC001682 NM_016645  
HGE024479 W01A061D07 pENTR-TOPO IRAL002J22 BC001682 NM_016645  

♦ W series clone contains a stop codon.

GNP_entry_W01A_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com/site/us/en/home.html


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR175379 ARi38H11 pGCAP10 NM_016645.2  
GCCGGCTACTTCCGCTGCTGTTTCGTAGCCGACTGCTGAAGGCTGGTTTGCGTCGACATG
HKR076945 ARe92G01 pKA1U5 NM_016645.2  
GGCCGACTGCTGAAGGCTGGTTTGCGTCGACATGGCGGTTACCCTGAGTCTCTTGCTGGG
HKR243747 ARiS109G03 pGCAP10 NM_016645.2  
GGCTGAAGGCTGGTTTGCGTCGACATGGCGGTTACCCTGAGTCTCTTGCTGGGCGGGCGC
HKR277855 ARiS194K15 pGCAP10 NM_016645.2  
GGAAGGCTGGTTTGCGTCGACATGGCGGTTACCCTGAGTCTCTTGCTGGGCGGGCGCGTT
HKR370908 RBd27E12 pGCAP10 NM_016645.2  
GGTTTCGTAGCCGACTGCTGAAGGCTGGTTTGCGTCGACATGGCGGTTACCCTGAGTCTC
HKR372929 RBd32F09 pGCAP10 NM_016645.2  
GGAAGGCTGGTTTGCGTCGACATGGCGGTTACCCTGAGTCTCTTGCTGGGCGGGCGCGTT
HKR433555 RBdS083O19 pGCAP10 NM_016645.2  
GGAAGGCTGGTTTGCGTCGACATGGCGGTTACCCTGAGTCTCTTGCTGGGCGGGCGCGTT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2017.08.26

Homo_sapiens_gene_info140110 - RDB_hum_GIxxxxxxxxx_html_170416.pl