Prev. | NRCD Clone C | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP06698

HP ID(1) HP06698
Gene ID(2) 55684
Gene Symbol finder C9orf86
Protein Name chromosome 9 open reading frame 86
RefSeq NM_024718.3
Length of RefSeq (bp) 3141
Chromosome 9q34.3
Reference DDBJ accession
UniGene Hs.370555

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe92F06 pKA1U5 GCCGCCGAGCCGGCGCCAAGATGGCGGCGCTGACTCCTGGAGAGCGGTCGCGCCGGAGGC
RBd60H07 pGCAP10 GGAGCCGGCGCCAAGATGGCGGCGCTGACTCCTGGAGAGCGGTCGCGCCGGAGGCCGCGG
RBdS154L11 pGCAP10 GGCGGGGGCCGGAGCGGAGCAGCCGCGGCTGAGGTTCCCGAGTCGCCGCTCGGGGCTGCG

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl