Prev. | 

RIKEN DNA Bank Human Resource - RABL6

Gene ID NCBI Gene 55684 |  KEGG hsa:55684
Gene Symbol RABL6
Protein Name RAB, member RAS oncogene family like 6
Synonyms C9orf86|PARF|RBEL1|pp8875
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX031769 IRAK079H01 pCMV-SPORT6 BC035786 NM_024718 Partial/var
HGY086348 IRAL015O12 pOTB7 BC002945 NM_024718 Partial
HGY096136 IRAL040F16 pOTB7 BC021095 NM_024718 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR076926 ARe92F06 pKA1U5 NM_024718.3  
GCCGCCGAGCCGGCGCCAAGATGGCGGCGCTGACTCCTGGAGAGCGGTCGCGCCGGAGGC
HKR384175 RBd60H07 pGCAP10 NM_024718.3  
GGAGCCGGCGCCAAGATGGCGGCGCTGACTCCTGGAGAGCGGTCGCGCCGGAGGCCGCGG
HKR461875 RBdS154L11 pGCAP10 NM_024718.3  
GGCGGGGGCCGGAGCGGAGCAGCCGCGGCTGAGGTTCCCGAGTCGCCGCTCGGGGCTGCG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.09

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl