Prev. | NRCD Clone T | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP06695

HP ID(1) HP06695
Gene ID(2) 153339
Gene Symbol finder TMEM167
Protein Name transmembrane protein 167
RefSeq NM_174909.4
Length of RefSeq (bp) 4608
Chromosome 5q14.2
Reference DDBJ accession
UniGene Hs.355606

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe92C08 pKA1U5 GCTGAGCCCCGGAAGGGTGATGTGGCTGCGGCATCGCCGGCCTCGCTATGTCTGCCATTT
ARi30E01 pGCAP10 GCCGCCTGAGCCCGGANGGTGATGTGGCTGCGGCATCGCCGGCCTCGCTATGTCTGCCAT
ARi58C02 pGCAP10 GGGGACATGCAGCCTCTTCCGCCTGAGCCCCGGAAGGGTGATGTGGCTGCGGCATCGCCG
RBdS022F04 pGCAP10 GATGCAGCCTCTTCCGCCTGAGCCCCGGAAGGGTGATGTGGCTGCGGCATCGCCGGCCTC

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl