Prev. | 

RIKEN DNA Bank Human Resource - TMEM167A

Gene ID NCBI Gene 153339 |  KEGG hsa:153339
Gene Symbol TMEM167A
Protein Name transmembrane protein 167A
Synonyms TMEM167
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY013864 IRAK034K24 pBluescriptR BC028585 NM_174909 Full
HGY095019 IRAL037J03 pDNR-LIB BC026285 NM_174909 Full
HGY102987 IRAL057H19 pDNR-LIB BC070122 NM_174909 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE096818 M01C042A18 pDONR221 MGC10-F09 BC026285 NM_174909  
HGE096866 M01C042C18 pDONR221 MGC10-F09 BC026285 NM_174909  
HGE096914 M01C042E18 pDONR221 MGC10-F09 BC026285 NM_174909  
HGE096962 M01C042G18 pDONR221 MGC10-F09 BC026285 NM_174909  
HGE097010 M01C042I18 pDONR221 MGC10-F09 BC026285 NM_174909  
HGE097058 M01C042K18 pDONR221 MGC10-F09 BC026285 NM_174909  
HGE097106 M01C042M18 pDONR221 MGC10-F09 BC026285 NM_174909  
HGE097154 M01C042O18 pDONR221 MGC10-F09 BC026285 NM_174909  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR076856 ARe92C08 pKA1U5 NM_174909.4  
GCTGAGCCCCGGAAGGGTGATGTGGCTGCGGCATCGCCGGCCTCGCTATGTCTGCCATTT
HKR172097 ARi30E01 pGCAP10 NM_174909.4  
GCCGCCTGAGCCCGGANGGTGATGTGGCTGCGGCATCGCCGGCCTCGCTATGTCTGCCAT
HKR183250 ARi58C02 pGCAP10 NM_174909.4  
GGGGACATGCAGCCTCTTCCGCCTGAGCCCCGGAAGGGTGATGTGGCTGCGGCATCGCCG
HKR408924 RBdS022F04 pGCAP10 NM_174909.4  
GATGCAGCCTCTTCCGCCTGAGCCCCGGAAGGGTGATGTGGCTGCGGCATCGCCGGCCTC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl