Prev. | NRCD Clone C | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP06679

HP ID(1) HP06679
Gene ID(2) 84909
Gene Symbol finder C9orf3
Protein Name chromosome 9 open reading frame 3
RefSeq NM_032823.3
Length of RefSeq (bp) 2834
Chromosome 9q22.32
Reference DDBJ accession
UniGene Hs.434253

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
RBb45C02 pGCAP1 GGCCCGCGCCGCGCCTGAGGTGATGCGGACCCCGGGCGGGCGCAGGGCGCGGGCTCCGGC

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl