Prev. |  KEGG KO K09606 > 

RIKEN DNA Bank Human Resource - AOPEP

Gene ID NCBI Gene 84909 |  KEGG hsa:84909
Gene Symbol AOPEP
Protein Name aminopeptidase O (putative)
Synonyms AP-O|APO|C90RF3|C9orf3|ONPEP
Ortholog resources KEGG ortholog (KEGG orthology K09606) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX005622 IRAK014A22 pCMV-SPORT6 BC029616 NM_032823
HGY096379 IRAL040P19 pOTB7 BC020194 NM_032823 Partial/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR338050 RBb45C02 pGCAP1 NM_032823.3  
GGCCCGCGCCGCGCCTGAGGTGATGCGGACCCCGGGCGGGCGCAGGGCGCGGGCTCCGGC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2020.01.10

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl