Prev. | NRCD Clone U | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP06673

HP ID(1) HP06673
Gene ID(2) 7371
Gene Symbol finder UCK2
Protein Name uridine-cytidine kinase 2
RefSeq NM_012474.3
Length of RefSeq (bp) 1284
Chromosome 1q23
Reference DDBJ accession
UniGene Hs.458360

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
RBb72F03 pGCAP1 GGGATTGGAGCAGCAGCATCACGCTGACCTCTGCCTGGGATGTAAACCGGACCAGCCGCT
RBd92A03 pGCAP10 GGGAGGCTGGGGCCAGACGCCTCGCCGCCTCCGCCTCGGCGAATAGCAGCGCGCTGCCCG
RBdS014N22 pGCAP10 GACAGGCAGCGGGAGGAGGGGCGGCGCGAACCATGGCCGGGGACAGCGAGCAGACCCTGC
RBdS154N04 pGCAP10 GATCACGCTGACCTCTGCCTGGGATGTAAACCGGACCAGCCGCTGCGGGCAAAGGAAGGC

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl