Prev. |  KEGG KO K00876 > 

RIKEN DNA Bank Human Resource - UCK2

Gene ID NCBI Gene 7371 |  KEGG hsa:7371
Gene Symbol UCK2
Protein Name uridine-cytidine kinase 2
Synonyms TSA903|UK|UMPK
Featured content Kinases Included in Myristoylated Kinase Library (human) in Boehm JS Cell 129 (6):1065-1079 (2007). PMID: 17574021.
Ortholog resource in our bank

  UCK2

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY086339 IRAL015O03 pOTB7 BC002906 NM_012474 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR348923 RBb72F03 pGCAP1 NM_012474.3  
GGGATTGGAGCAGCAGCATCACGCTGACCTCTGCCTGGGATGTAAACCGGACCAGCCGCT
HKR396803 RBd92A03 pGCAP10 NM_012474.3  
GGGAGGCTGGGGCCAGACGCCTCGCCGCCTCCGCCTCGGCGAATAGCAGCGCGCTGCCCG
HKR405934 RBdS014N22 pGCAP10 NM_012474.3  
GACAGGCAGCGGGAGGAGGGGCGGCGCGAACCATGGCCGGGGACAGCGAGCAGACCCTGC
HKR461916 RBdS154N04 pGCAP10 NM_012474.3  
GATCACGCTGACCTCTGCCTGGGATGTAAACCGGACCAGCCGCTGCGGGCAAAGGAAGGC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl