Prev. | Human A to Z list > U > 

RIKEN DNA Bank Human Resource - UCK2

Gene ID (NCBI) 7371
Gene Symbol UCK2
Protein Name uridine-cytidine kinase 2
Synonyms TSA903|UK|UMPK
Databases KEGG link 01 |  NCBI Gene link 01
Featured content Kinases Included in Myristoylated Kinase Library (human) in Boehm JS Cell 129 (6):1065-1079 (2007). PMID: 17574021.


Genome Network Project (GNP) Human Full-Length cDNA Clone link 01

Catalog number Clone name Vector(1) Sequence CDS status(3)
Submitted (DDBJ)(2) Refered (NCBI mRNA)
HGY086339 IRAL015O03 pOTB7 BC002906 NM_012474 Full

(1) Extra 1,250 YEN (license fee) is required for Gateway® Expression Clone (pCMV SPORT6 and related vectors).
(2) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(3) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_160505.csv
GNP_full_IRAL_160505.csv


NRCD Human Full-Legth cDNA Clone link 01

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR348923 RBb72F03 pGCAP1 NM_012474.3  
GGGATTGGAGCAGCAGCATCACGCTGACCTCTGCCTGGGATGTAAACCGGACCAGCCGCT
HKR396803 RBd92A03 pGCAP10 NM_012474.3  
GGGAGGCTGGGGCCAGACGCCTCGCCGCCTCCGCCTCGGCGAATAGCAGCGCGCTGCCCG
HKR405934 RBdS014N22 pGCAP10 NM_012474.3  
GACAGGCAGCGGGAGGAGGGGCGGCGCGAACCATGGCCGGGGACAGCGAGCAGACCCTGC
HKR461916 RBdS154N04 pGCAP10 NM_012474.3  
GATCACGCTGACCTCTGCCTGGGATGTAAACCGGACCAGCCGCTGCGGGCAAAGGAAGGC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2016.12.28

Homo_sapiens_gene_info140110 - RDB_hum_GIxxxxxxxxx_html_161013.pl