Prev. | NRCD Clone N | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP06652

HP ID(1) HP06652
Gene ID(2) 4828
Gene Symbol finder NMB
Protein Name neuromedin B
RefSeq NM_021077.3
Length of RefSeq (bp) 1046
Chromosome 15q22-qter
Reference DDBJ accession
UniGene Hs.386470

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
RBb70B08 pGCAP1 TGGAGCGGCCGGGAAGCGCGCCCGAACGAAGCCGCGGCCCGGGCACAGCCATGGCCCGGC
RBd80E11 pGCAP10 GAGGGGCGCGGATTTAAAAGGATCGAAGGCAGCCCCGGAGCCCAGCGGCCGGGAAGCGCG

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl