Prev. |  KEGG KO K05223 > 

RIKEN DNA Bank Human Resource - NMB

Gene ID NCBI Gene 4828 |  KEGG hsa:4828
Gene Symbol NMB
Protein Name neuromedin B
Synonyms -
Ortholog resource in our bank

  NMB

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX005091 IRAK012M03 pCMV-SPORT6 BC008603 NM_205858 Full/var
HGY081234 IRAL003B10 pOTB7 BC007407 NM_205858 Full/var
HGY084138 IRAL010F18 pOTB7 BC007431 NM_205858 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE045311 W01A113E15 pENTR-TOPO IRAL010F18 BC007407 NM_205858  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR348032 RBb70B08 pGCAP1 NM_021077.3  
TGGAGCGGCCGGGAAGCGCGCCCGAACGAAGCCGCGGCCCGGGCACAGCCATGGCCCGGC
HKR392107 RBd80E11 pGCAP10 NM_021077.3  
GAGGGGCGCGGATTTAAAAGGATCGAAGGCAGCCCCGGAGCCCAGCGGCCGGGAAGCGCG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl