Prev. | NRCD Clone T | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP06650

HP ID(1) HP06650
Gene ID(2) 201292
Gene Symbol finder TRIM65
Protein Name tripartite motif-containing 65
RefSeq NM_173547.2
Length of RefSeq (bp) 3429
Chromosome 17q25.1
Reference DDBJ accession
UniGene Hs.189823

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
RBb69H09 pGCAP1 GGGGGCCCGCCTGGCTCTCGCCGCCGCCGGGCCATGGCCGCGCAGCTGCTGGAGGAGAAG

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl