Prev. |  KEGG KO K12031 > 

RIKEN DNA Bank Human Resource - TRIM65

Gene ID NCBI Gene 201292 |  KEGG hsa:201292
Gene Symbol TRIM65
Protein Name tripartite motif containing 65
Synonyms 4732463G12Rik
Ortholog resource in our bank

  TRIM65

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX066481 IRAK166D09 pCMV-SPORT6 BC073831 NM_173547 Partial/var
HGY087423 IRAL018J07 pOTB7 BC006138 NM_173547 Partial
HGY095657 IRAL039C09 pOTB7 BC021259 NM_173547 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR347777 RBb69H09 pGCAP1 NM_173547.2  
GGGGGCCCGCCTGGCTCTCGCCGCCGCCGGGCCATGGCCGCGCAGCTGCTGGAGGAGAAG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.09

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl