Prev. | NRCD Clone C | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP06647

HP ID(1) HP06647
Gene ID(2) 286333
Gene Symbol finder C9orf109
Protein Name chromosome 9 open reading frame 109
RefSeq NR_024366.1
Length of RefSeq (bp) 5802
Chromosome 9q32
Reference DDBJ accession
UniGene Hs.99052

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
RBb69D11 pGCAP1 GGAGCCCAACCGCCGCCTCCAACGGGACTGGACCAGACCGGGTGGGACCGGACCGCGGTT

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl