Prev. | 

RIKEN DNA Bank Human Resource - FAM225A

Gene ID NCBI Gene 286333 |  KEGG hsa:286333
Gene Symbol FAM225A
Protein Name family with sequence similarity 225 member A
Synonyms C9orf109|LINC00256A|NCRNA00256A
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR347683 RBb69D11 pGCAP1 NR_024366.1 VA done
GGAGCCCAACCGCCGCCTCCAACGGGACTGGACCAGACCGGGTGGGACCGGACCGCGGTT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.10.11

Homo_sapiens_gene_info230514.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl