Prev. | NRCD Clone P | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP06622

HP ID(1) HP06622
Gene ID(2) 9536
Gene Symbol finder PTGES
Protein Name prostaglandin E synthase
RefSeq NM_004878.4
Length of RefSeq (bp) 1787
Chromosome 9q34.3
Reference DDBJ accession
UniGene Hs.146688

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe91C06 pKA1U5 GAGAGATGCCTGCCCACAGCCTGGTGATGAGCAGCCCGGCCCTCCCGGCCTTCCTGCTCT
ARiS109E17 pGCAP10 GAGANNNNNCNGCCCACCGCCTGGTGATGAGCAGCCCGGCCCTCCCGGCCTTCCTGCTCT

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl