Prev. |  KEGG KO K15729 > 

RIKEN DNA Bank Human Resource - PTGES

Gene ID NCBI Gene 9536 |  KEGG hsa:9536
Gene Symbol PTGES
Protein Name prostaglandin E synthase
Synonyms MGST-IV|MGST1-L1|MGST1L1|MPGES|PGES|PIG12|PP102|PP1294|TP53I12|mPGES-1
Ortholog resources KEGG ortholog (KEGG orthology K15729) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX008771 IRAK021P11 pCMV-SPORT6 BC018201 NM_004878
HGY085252 IRAL013C04 pOTB7 BC008280 NM_004878 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE013449 W01A033K09 pENTR-TOPO IRAL013C04 BC008280 NM_004878  
HGE013455 W01A033K15 pENTR-TOPO IRAL013C04 BC008280 NM_004878  

♦ W series clone contains a stop codon.

GNP_entry_W01A_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR076454 ARe91C06 pKA1U5 NM_004878.4  
GAGAGATGCCTGCCCACAGCCTGGTGATGAGCAGCCCGGCCCTCCCGGCCTTCCTGCTCT
HKR243713 ARiS109E17 pGCAP10 NM_004878.4  
GAGANNNNNCNGCCCACCGCCTGGTGATGAGCAGCCCGGCCCTCCCGGCCTTCCTGCTCT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2020.01.07

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl