Prev. | NRCD Clone O | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP06621

HP ID(1) HP06621
Gene ID(2) 220213
Gene Symbol finder OTUD1
Protein Name OTU domain containing 1
RefSeq XR_040065.1
Length of RefSeq (bp) 3512
Chromosome 10p12.2
Reference DDBJ accession
UniGene Hs.499042

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe91C01 pKA1U5 GATTCCAGTGAGTCCACGTGACGCGGCCGCGAGGCCTGTAGGTAAACAACCGCGGCCCCG
ARi47C03 pGCAP10 GGCAGCTCTACAGCAGCGTCTGCACCCACTACCCCGCCGGGGCCCCGGGTCCCACGGCCG
ARiS049O19 pGCAP10 GCGGCTCTACATCANCNTCTGCACCNACTACCCCGCCGGGNCCCCAGNTCCNNNNNCCGC

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl