Prev. |  KEGG KO K13716 > 

RIKEN DNA Bank Human Resource - OTUD1

Gene ID NCBI Gene 220213 |  KEGG hsa:220213
Gene Symbol OTUD1
Protein Name OTU deubiquitinase 1
Synonyms DUBA7|OTDC1
Ortholog resources KEGG ortholog (KEGG orthology K13716) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR076449 ARe91C01 pKA1U5 XR_040065.1  
GATTCCAGTGAGTCCACGTGACGCGGCCGCGAGGCCTGTAGGTAAACAACCGCGGCCCCG
HKR178851 ARi47C03 pGCAP10 XR_040065.1  
GGCAGCTCTACAGCAGCGTCTGCACCCACTACCCCGCCGGGGCCCCGGGTCCCACGGCCG
HKR219955 ARiS049O19 pGCAP10 XR_040065.1  
GCGGCTCTACATCANCNTCTGCACCNACTACCCCGCCGGGNCCCCAGNTCCNNNNNCCGC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2021.03.25

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl