Prev. | NRCD Clone N | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP06608

HP ID(1) HP06608
Gene ID(2) 26012
Gene Symbol finder NELF
Protein Name nasal embryonic LHRH factor
RefSeq NM_015537.4
Length of RefSeq (bp) 3646
Chromosome 9q34.3
Reference DDBJ accession
UniGene Hs.455336

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe90B07 pKA1U5 GAANGCACCGCCCTCTCCCGGGAGCGGCGGCACACGTCCTATTNGCCGGGNTGCGGCCAT
RBdS177B08 pGCAP10 GATGGGCGGGGCCGGCCCTCNGTCCGGGCAGCGCTCTCCCGGGAGCGGCGGCACGCGCGG

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl