Prev. | 

RIKEN DNA Bank Human Resource - NSMF

Gene ID NCBI Gene 26012 |  KEGG hsa:26012
Gene Symbol NSMF
Protein Name NMDA receptor synaptonuclear signaling and neuronal migration factor
Synonyms HH9|NELF
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX008153 IRAK020G09 pCMV-SPORT6 BC016862 NM_015537 Partial
HGX069849 IRAK174K09 pCMV-SPORT6 BC072412 NM_015537 Full
HGY085308 IRAL013E12 pOTB7 BC004318 NM_015537 Partial

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE081646 M01C004B22 pDONR221 04-134-2_2-H11 AK074602 ENST00000339554  
HGE081694 M01C004D22 pDONR221 04-134-2_2-H11 AK074602 ENST00000339554  
HGE081742 M01C004F22 pDONR221 04-134-2_2-H11 AK074602 ENST00000339554  
HGE081790 M01C004H22 pDONR221 04-134-2_2-H11 AK074602 ENST00000339554  
HGE081838 M01C004J22 pDONR221 04-134-2_2-H11 AK074602 ENST00000339554  
HGE081886 M01C004L22 pDONR221 04-134-2_2-H11 AK074602 ENST00000339554  
HGE081934 M01C004N22 pDONR221 04-134-2_2-H11 AK074602 ENST00000339554  
HGE081982 M01C004P22 pDONR221 04-134-2_2-H11 AK074602 ENST00000339554  
HGE085207 M01C013A07 pDONR221 FLJ04-A04 AK074602 ENST00000339554  
HGE085255 M01C013C07 pDONR221 FLJ04-A04 AK074602 ENST00000339554  
HGE085303 M01C013E07 pDONR221 FLJ04-A04 AK074602 ENST00000339554  
HGE085351 M01C013G07 pDONR221 FLJ04-A04 AK074602 ENST00000339554  
HGE085399 M01C013I07 pDONR221 FLJ04-A04 AK074602 ENST00000339554  
HGE085447 M01C013K07 pDONR221 FLJ04-A04 AK074602 ENST00000339554  
HGE085495 M01C013M07 pDONR221 FLJ04-A04 AK074602 ENST00000339554  
HGE085543 M01C013O07 pDONR221 FLJ04-A04 AK074602 ENST00000339554  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR076031 ARe90B07 pKA1U5 NM_015537.4  
GAANGCACCGCCCTCTCCCGGGAGCGGCGGCACACGTCCTATTNGCCGGGNTGCGGCCAT
HKR470832 RBdS177B08 pGCAP10 NM_015537.4  
GATGGGCGGGGCCGGCCCTCNGTCCGGGCAGCGCTCTCCCGGGAGCGGCGGCACGCGCGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl