Prev. | NRCD Clone C | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP06606

HP ID(1) HP06606
Gene ID(2) 727
Gene Symbol finder C5
Protein Name complement component 5
RefSeq NM_001735.2
Length of RefSeq (bp) 5480
Chromosome 9q33-q34
Reference DDBJ accession
UniGene Hs.494997

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe90A06 pKA1U5 GCCCGCCTCTTTTGCAGCCAGCGCGCTAGGATGCCGGGGTAGTCTTGGGCGCGAGGCTTC

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl