Prev. |  KEGG KO K03994 > 

RIKEN DNA Bank Human Resource - C5

Gene ID NCBI Gene 727 |  KEGG hsa:727
Gene Symbol C5
Protein Name complement C5
Synonyms C5D|C5a|C5b|CPAMD4|ECLZB
Ortholog resources KEGG ortholog (KEGG orthology K03994) in the DNA Bank
Featured content SARS-CoV-2 relevant human genes
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR076006 ARe90A06 pKA1U5 NM_001735.2  
GCCCGCCTCTTTTGCAGCCAGCGCGCTAGGATGCCGGGGTAGTCTTGGGCGCGAGGCTTC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2021.02.18

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl