RIKEN DNA Bank Human Resource

RIKEN DNA Bank Human Resource - C5

Gene ID	NCBI Gene 727 \| KEGG hsa:727
Gene Symbol	C5
Protein Name	complement C5
Synonyms	C5D\|C5a\|C5b\|CPAMD4\|ECLZB
Featured content	SARS-CoV-2 relevant human genes

Ortholog resource in our bank

  C5

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number	Clone name	Vector	CDS comparison
	Clone name	Vector	Refered mRNA⁽¹⁾	CDS status
	5'-terminal sequence⁽²⁾
HKR076006	ARe90A06	pKA1U5	NM_001735.2
HKR076006	GCCCGCCTCTTTTGCAGCCAGCGCGCTAGGATGCCGGGGTAGTCTTGGGCGCGAGGCTTC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.09

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl