Prev. | NRCD Clone T | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP06605

HP ID(1) HP06605
Gene ID(2) 9537
Gene Symbol finder TP53I11
Protein Name tumor protein p53 inducible protein 11
RefSeq NM_006034.3
Length of RefSeq (bp) 3518
Chromosome 11p11.2
Reference DDBJ accession
UniGene Hs.554791

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe89G04 pKA1U5 GGCCCTGCCCTGNTCCTGCCCTGCCCTGCCCTGCCCTGCCCTGCCCTGCACTGCCCGGCC
RBd23G12 pGCAP10 CGGCCGGCCGATGAGACTCGGTAAGCCCCGGCCGCGCAGGGCGCCGCGCGCAGTCCAGCC
RBd66G04 pGCAP10 GGAGANGANGGACCAGCGCGGGCCGCCAGACTCGGTAAGCCCCGGCCGCGCAGGGCGCCG
RBdS014J02 pGCAP10 GAGCGCGGGCCGCCAGACTCGGTAAGCCCCGGCCGCGCAGGGCGCCGCGCGCAGTCCAGC
RBdS110F10 pGCAP10 GAGTCTTTGCCCCCGCAGGGCCGCGGACGGAGGTGGTGGCGGAGTTCCCGCTGCCCACAA

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl