Prev. | 

RIKEN DNA Bank Human Resource - TP53I11

Gene ID NCBI Gene 9537 |  KEGG hsa:9537
Gene Symbol TP53I11
Protein Name tumor protein p53 inducible protein 11
Synonyms PIG11
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY066944 IRAK167F24 pBluescriptR BC071606 NM_006034 Full
HGY080487 IRAL001D15 pOTB7 BC003010 NM_006034
HGY083817 IRAL009J01 pOTB7 BC003010 NM_006034

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR075748 ARe89G04 pKA1U5 NM_006034.3  
GGCCCTGCCCTGNTCCTGCCCTGCCCTGCCCTGCCCTGCCCTGCCCTGCACTGCCCGGCC
HKR369356 RBd23G12 pGCAP10 NM_006034.3  
CGGCCGGCCGATGAGACTCGGTAAGCCCCGGCCGCGCAGGGCGCCGCGCGCAGTCCAGCC
HKR386548 RBd66G04 pGCAP10 NM_006034.3  
GGAGANGANGGACCAGCGCGGGCCGCCAGACTCGGTAAGCCCCGGCCGCGCAGGGCGCCG
HKR405818 RBdS014J02 pGCAP10 NM_006034.3  
GAGCGCGGGCCGCCAGACTCGGTAAGCCCCGGCCGCGCAGGGCGCCGCGCGCAGTCCAGC
HKR444130 RBdS110F10 pGCAP10 NM_006034.3  
GAGTCTTTGCCCCCGCAGGGCCGCGGACGGAGGTGGTGGCGGAGTTCCCGCTGCCCACAA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl