Prev. | NRCD Clone O | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP06596

HP ID(1) HP06596
Gene ID(2) 55593
Gene Symbol finder OTUD5
Protein Name OTU domain containing 5
RefSeq NM_017602.3
Length of RefSeq (bp) 2941
Chromosome Xp11.23
Reference DDBJ accession
UniGene Hs.496098

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe88F07 pKA1U5 GGGGTTTGTTGGGGGGTACTCGGCAGTGCAGCCATGACTATACTCCCCAAAAAGAAGCCG

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl