Prev. |  KEGG KO K12655 > 

RIKEN DNA Bank Human Resource - OTUD5

Gene ID NCBI Gene 55593 |  KEGG hsa:55593
Gene Symbol OTUD5
Protein Name OTU deubiquitinase 5
Synonyms DUBA
Ortholog resources KEGG ortholog (KEGG orthology K12655) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX025066 IRAK062L02 pCMV-SPORT6 BC028225 NM_017602 Partial/var
HGY081140 IRAL002O04 pOTB7 BC009917 NM_017602 Full
HGY083980 IRAL009P20 pOTB7 BC009917 NM_017602 Full
HGY091181 IRAL027P21 pOTB7 BC011738 NM_017602 Partial/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE081260 M01C003C12 pDONR221 04-134-2_2-B06 BC009917 NM_017602  
HGE081308 M01C003E12 pDONR221 04-134-2_2-B06 BC009917 NM_017602  
HGE081356 M01C003G12 pDONR221 04-134-2_2-B06 BC009917 NM_017602  
HGE081404 M01C003I12 pDONR221 04-134-2_2-B06 BC009917 NM_017602  
HGE081452 M01C003K12 pDONR221 04-134-2_2-B06 BC009917 NM_017602  
HGE081500 M01C003M12 pDONR221 04-134-2_2-B06 BC009917 NM_017602  
HGE081548 M01C003O12 pDONR221 04-134-2_2-B06 BC009917 NM_017602  
HGE111237 M01C078B13 pDONR221 06-2_02-G07 BC009917 NM_017602  
HGE111285 M01C078D13 pDONR221 06-2_02-G07 BC009917 NM_017602  
HGE111333 M01C078F13 pDONR221 06-2_02-G07 BC009917 NM_017602  
HGE097636 M01C044B12 pDONR221 MGC11-H06 BC009917 NM_017602  
HGE097684 M01C044D12 pDONR221 MGC11-H06 BC009917 NM_017602  
HGE097732 M01C044F12 pDONR221 MGC11-H06 BC009917 NM_017602  
HGE097780 M01C044H12 pDONR221 MGC11-H06 BC009917 NM_017602  
HGE097828 M01C044J12 pDONR221 MGC11-H06 BC009917 NM_017602  
HGE097876 M01C044L12 pDONR221 MGC11-H06 BC009917 NM_017602  
HGE097924 M01C044N12 pDONR221 MGC11-H06 BC009917 NM_017602  
HGE097972 M01C044P12 pDONR221 MGC11-H06 BC009917 NM_017602  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR075327 ARe88F07 pKA1U5 NM_017602.3  
GGGGTTTGTTGGGGGGTACTCGGCAGTGCAGCCATGACTATACTCCCCAAAAAGAAGCCG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2020.01.17

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl