Prev. | NRCD Clone P | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP06594

HP ID(1) HP06594
Gene ID(2) 23275
Gene Symbol finder POFUT2
Protein Name protein O-fucosyltransferase 2
RefSeq NM_015227.3
Length of RefSeq (bp) 4843
Chromosome 21q22.3
Reference DDBJ accession
UniGene Hs.592164

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe88E08 pKA1U5 GGTGCGTGGCCGCCCGGGGCCATGGCGACACTCAGCTTCGTCTTCCTGCTGCTGGGGGCA
ARe98C10 pKA1U5 GGGGGCCATGGCGACACTCAGCTTCGTCTTCCTGCTGCTGGGGGCAGTGTCCTGGCCTCC

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl