Prev. |  KEGG KO K03691 > 

RIKEN DNA Bank Human Resource - POFUT2

Gene ID NCBI Gene 23275 |  KEGG hsa:23275
Gene Symbol POFUT2
Protein Name protein O-fucosyltransferase 2
Synonyms C21orf80|FUT13
Ortholog resource in our bank

  POFUT2

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX055790 IRAK139H22 pCMV-SPORT6 BC064623 NM_133635 Full
HGY082358 IRAL005O22 pOTB7 BC000626 NM_133635 Partial/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE096010 M01C040A10 pDONR221 MGC09-F05 BC064623 NM_133634  
HGE096058 M01C040C10 pDONR221 MGC09-F05 BC064623 NM_133634  
HGE096106 M01C040E10 pDONR221 MGC09-F05 BC064623 NM_133634  
HGE096154 M01C040G10 pDONR221 MGC09-F05 BC064623 NM_133634  
HGE096202 M01C040I10 pDONR221 MGC09-F05 BC064623 NM_133634  
HGE096250 M01C040K10 pDONR221 MGC09-F05 BC064623 NM_133634  
HGE096298 M01C040M10 pDONR221 MGC09-F05 BC064623 NM_133634  
HGE096346 M01C040O10 pDONR221 MGC09-F05 BC064623 NM_133634  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR075304 ARe88E08 pKA1U5 NM_015227.3  
GGTGCGTGGCCGCCCGGGGCCATGGCGACACTCAGCTTCGTCTTCCTGCTGCTGGGGGCA
HKR079258 ARe98C10 pKA1U5 NM_015227.3  
GGGGGCCATGGCGACACTCAGCTTCGTCTTCCTGCTGCTGGGGGCAGTGTCCTGGCCTCC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl