Prev. | NRCD Clone R | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP06592

HP ID(1) HP06592
Gene ID(2) 54502
Gene Symbol finder RBM47
Protein Name RNA binding motif protein 47
RefSeq NM_019027.3
Length of RefSeq (bp) 4504
Chromosome 4p13-p12
Reference DDBJ accession
UniGene Hs.518727

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe88D12 pKA1U5 GGAGGACATTGAAAATAAGATGGAACCCATCCACATAAGGATTTGCCTCAAAGGGCACTG

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl