Prev. | NRCD Clone T | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP06581

HP ID(1) HP06581
Gene ID(2) 55720
Gene Symbol finder TSR1
Protein Name TSR1, 20S rRNA accumulation, homolog (S. cerevisiae)
RefSeq NM_018128.4
Length of RefSeq (bp) 4890
Chromosome 17p13.3
Reference DDBJ accession
UniGene Hs.388170

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe87B08 pKA1U5 GAGTGCTGACTCCGTACACGCGCGCTGCGGCATGGCGGCCCACCGCCCCGGCCCGCTCAA

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl