Prev. |  KEGG KO K14799 > 

RIKEN DNA Bank Human Resource - TSR1

Gene ID NCBI Gene 55720 |  KEGG hsa:55720
Gene Symbol TSR1
Protein Name TSR1 ribosome maturation factor
Synonyms -
Ortholog resource in our bank

  TSR1

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY095826 IRAL039J10 pOTB7 BC019090 NM_018128 Partial/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE086410 M01C016A10 pDONR221 FLJ05-F05 AK026565 NM_018128  
HGE086458 M01C016C10 pDONR221 FLJ05-F05 AK026565 NM_018128  
HGE086506 M01C016E10 pDONR221 FLJ05-F05 AK026565 NM_018128  
HGE086554 M01C016G10 pDONR221 FLJ05-F05 AK026565 NM_018128  
HGE086602 M01C016I10 pDONR221 FLJ05-F05 AK026565 NM_018128  
HGE086650 M01C016K10 pDONR221 FLJ05-F05 AK026565 NM_018128  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR074832 ARe87B08 pKA1U5 NM_018128.4  
GAGTGCTGACTCCGTACACGCGCGCTGCGGCATGGCGGCCCACCGCCCCGGCCCGCTCAA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.09

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl