Prev. | NRCD Clone N | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP06579

HP ID(1) HP06579
Gene ID(2) 55247
Gene Symbol finder NEIL3
Protein Name nei endonuclease VIII-like 3 (E. coli)
RefSeq NM_018248.2
Length of RefSeq (bp) 2402
Chromosome 4q34.3
Reference DDBJ accession
UniGene Hs.405467

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe87B01 pKA1U5 GAGTGCCCGCGCAGCGTTGAGTTGCACAGCGGTATTCTCACCAGACCCTGCAATCGGTGG

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl