Prev. |  KEGG KO K10569 > 

RIKEN DNA Bank Human Resource - NEIL3

Gene ID NCBI Gene 55247 |  KEGG hsa:55247
Gene Symbol NEIL3
Protein Name nei like DNA glycosylase 3
Synonyms FGP2|FPG2|NEI3|ZGRF3|hFPG2|hNEI3
Ortholog resources KEGG ortholog (KEGG orthology K10569) in the DNA Bank
Featured content DNA repair (human)
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY096964 IRAL042G20 pOTB7 BC025954 NM_018248 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR074825 ARe87B01 pKA1U5 NM_018248.2  
GAGTGCCCGCGCAGCGTTGAGTTGCACAGCGGTATTCTCACCAGACCCTGCAATCGGTGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2020.01.17

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl