Prev. | NRCD Clone T | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP06574

HP ID(1) HP06574
Gene ID(2) 54472
Gene Symbol finder TOLLIP
Protein Name toll interacting protein
RefSeq NM_019009.2
Length of RefSeq (bp) 3615
Chromosome 11p15.5
Reference DDBJ accession
UniGene Hs.368527

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe86D08 pKA1U5 GGCGGCTGTCAGCTGACTGTGGCGGCGGCGGCCTCGAGGTGACAACTGTCTCCGTCGCAG
ARf07H08 pKA1U5 GGCCGGGGGCGGGGCGCGGCGGCTGTCAGCTGACTGTGGCGGCGGCGGCCTCGAGGTGAC
ARi30G12 pGCAP10 GAGCTGACTGTGGCGGCGGCGGCCTCGAGGTGACAACTGTCTCCGTCGCAGGCTCCGGCG
RBd47E07 pGCAP10 GGCGGCGGCTGTCAGCTGACTGTGGCGGCGGCGGCCTCGAGGTGACAACTGTCTCCGTCG
RBdS083I08 pGCAP10 GAGCTGACTGTGGCGGCGGCGGCCTCGAGGTGACAACTGTCTCCGTCGCAGGCTCCGGCG

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl