DNA Bank Top |  KEGG KO K05402 > 

RIKEN DNA Bank Human Resource - TOLLIP

Gene ID NCBI Gene 54472 |  KEGG hsa:54472
Gene Symbol TOLLIP
Protein Name toll interacting protein
Synonyms IL-1RAcPIP
Featured content MAPK p38 inhibitor screening

Link

Ortholog resource in our bank

  TOLLIP


External database

human TOLLIP

Individualy Deposited Resource

Catalog number Name of Resource Description CDS comparison
Refered (NCBI mRNA) CDS status(1)
RDB08208 pcDNA3HA-Tollip Expression vector of human Tollip cDNA, HA-tagged    

(1) CDS status was determined by comparing the plasmid sequence with NCBI RefSeq mRNA.

webcatalog20240727.tab


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX007813 IRAK019I21 pCMV-SPORT6 BC018272 NM_019009 Full
HGY082740 IRAL006O04 pOTB7 BC004420 NM_019009 Full
HGY091930 IRAL029N18 pOTB7 BC012057 NM_019009 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the plasmid sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2024May11.csv
GNP_full_IRAL_2024May11.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE010194 W01A025I02 pENTR-TOPO flj0042b14 AK096693 NM_019009  
HGE010196 W01A025I04 pENTR-TOPO flj0042b14 AK096693 NM_019009  
HGE010198 W01A025I06 pENTR-TOPO flj0042b14 AK096693 NM_019009  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2024May11.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR074480 ARe86D08 pKA1U5 NM_019009.2  
GGCGGCTGTCAGCTGACTGTGGCGGCGGCGGCCTCGAGGTGACAACTGTCTCCGTCGCAG
HKR082976 ARf07H08 pKA1U5 NM_019009.2  
GGCCGGGGGCGGGGCGCGGCGGCTGTCAGCTGACTGTGGCGGCGGCGGCCTCGAGGTGAC
HKR172156 ARi30G12 pGCAP10 NM_019009.2  
GAGCTGACTGTGGCGGCGGCGGCCTCGAGGTGACAACTGTCTCCGTCGCAGGCTCCGGCG
HKR378903 RBd47E07 pGCAP10 NM_019009.2  
GGCGGCGGCTGTCAGCTGACTGTGGCGGCGGCGGCCTCGAGGTGACAACTGTCTCCGTCG
HKR433400 RBdS083I08 pGCAP10 NM_019009.2  
GAGCTGACTGTGGCGGCGGCGGCCTCGAGGTGACAACTGTCTCCGTCGCAGGCTCCGGCG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2024May11.csv
NRCDhumcloneList_RB_2024May11.csv


2024.09.26

Homo_sapiens_gene_info230514.csv - RDB_hum_GIxxxxxxxxx_html_240727.pl