Prev. | NRCD Clone N | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP06571

HP ID(1) HP06571
Gene ID(2) 10276
Gene Symbol finder NET1
Protein Name neuroepithelial cell transforming gene 1
RefSeq NM_005863.3
Length of RefSeq (bp) 3297
Chromosome 10p15
Reference DDBJ accession
UniGene Hs.25155

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARi36C02 pGCAP10 GATCCCCGGATGACGGCGGTGGCGGCTGCAGTCCGCTGACAGGCGCTTTCTGCCTGGCAG
RBb66B03 pGCAP1 GAGTCCGCTGACAGGCGCTTTCTGCCTGGCAGAGGCTGGCGGGCATCGTGCCCGTCCCTG
RBdS105K07 pGCAP10 GGTGCTCCACCGCGGCGAGAGGCATGGGCACGTGGCTGCCGAGGGTGGCCGAGCTCTGGG

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl