Prev. |  KEGG KO K20683 > 

RIKEN DNA Bank Human Resource - NET1

Gene ID NCBI Gene 10276 |  KEGG hsa:10276
Gene Symbol NET1
Protein Name neuroepithelial cell transforming 1
Synonyms ARHGEF8|NET1A
Ortholog resource in our bank

  NET1

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX001293 IRAK003D21 pCMV-SPORT6 BC010285 NM_005863 Full
HGX046245 IRAK115K05 pCMV-SPORT6 BC053553 NM_005863

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR174450 ARi36C02 pGCAP10 NM_005863.3  
GATCCCCGGATGACGGCGGTGGCGGCTGCAGTCCGCTGACAGGCGCTTTCTGCCTGGCAG
HKR346427 RBb66B03 pGCAP1 NM_005863.3  
GAGTCCGCTGACAGGCGCTTTCTGCCTGGCAGAGGCTGGCGGGCATCGTGCCCGTCCCTG
HKR442247 RBdS105K07 pGCAP10 NM_005863.3  
GGTGCTCCACCGCGGCGAGAGGCATGGGCACGTGGCTGCCGAGGGTGGCCGAGCTCTGGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl