Prev. | Human A to Z list > N > 

RIKEN DNA Bank Human Resource - NET1

Gene ID (NCBI) 10276
Gene Symbol NET1
Protein Name neuroepithelial cell transforming 1
Synonyms ARHGEF8|NET1A
Databases KEGG link 01 |  NCBI Gene link 01


Genome Network Project (GNP) Human Full-Length cDNA Clone link 01

Catalog number Clone name Vector(1) Sequence CDS status(3)
Submitted (DDBJ)(2) Refered (NCBI mRNA)
HGX001293 IRAK003D21 pCMV-SPORT6 BC010285 NM_005863 Full
HGX046245 IRAK115K05 pCMV-SPORT6 BC053553 NM_005863

(1) Extra 1,250 YEN (license fee) is required for Gateway® Expression Clone (pCMV SPORT6 and related vectors).
(2) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(3) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_160505.csv
GNP_full_IRAL_160505.csv


NRCD Human Full-Legth cDNA Clone link 01

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1)
5'-terminal sequence(2)
HKR174450 ARi36C02 pGCAP10 NM_005863.3
GATCCCCGGATGACGGCGGTGGCGGCTGCAGTCCGCTGACAGGCGCTTTCTGCCTGGCAG
HKR346427 RBb66B03 pGCAP1 NM_005863.3
GAGTCCGCTGACAGGCGCTTTCTGCCTGGCAGAGGCTGGCGGGCATCGTGCCCGTCCCTG
HKR442247 RBdS105K07 pGCAP10 NM_005863.3
GGTGCTCCACCGCGGCGAGAGGCATGGGCACGTGGCTGCCGAGGGTGGCCGAGCTCTGGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2016.08.04

Homo_sapiens_gene_info140110 - RDB_hum_GIxxxxxxxxx_html_160505.pl