Prev. | NRCD Clone R | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP06563

HP ID(1) HP06563
Gene ID(2)
Gene Symbol finder RNF44(upstream)
Protein Name
RefSeq
Length of RefSeq (bp)
Chromosome 5q35.2
Reference DDBJ accession
UniGene

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
RBb65E01 pGCAP1 GGGGGGTCCTGGAAGCTGCGCAGCCGGTGTGGGCCCCGCGCGCCCGGGTGGTGAGGTCCG

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl